Cdc40^em1Jgg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdc40^em1Jgg
• Name: cell division cycle 40; endonuclease-mediated mutation 1, Joseph Gleeson
• MGI ID: MGI:6509468
• Synonyms: Prp17^p.P95A
• Gene: Cdc40 Location: Chr10:40707617-40759139 bp, - strand Genetic Position: Chr10, 22.06 cM, cytoband B1
• Alliance: Cdc40^em1Jgg page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: Using a crRNA (targeting TTCCTTATATCGTTGCAGTT), tracrRNA and an ssODN template (GGATTAGAGTTGAAAATACATTGTAATTTCAGGATCCTTCTTTTCCTTCCTTATATCGTTGCAGTTTGGAGCAGAAAATCCCTTTCGAACACAGCAAATGGCTGCCCCTAGAAATATGCTTTCTGGGTATGCAGAGCCAGC) with CRISPR/Cas9 technology, a C-to-G mutation (G-to-C on forward strand) was engineered to change proline codon 95 (CCA) to an alanine codon (GCA) (p.P95A). This mutation creates a non-isomerizable form of the encoded peptide. (J:300487)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cdc40 Mutation: 37 strains or lines available

References

• Original: J:300487 Chai G, et al., Mutations in Spliceosomal Genes PPIL1 and PRP17 Cause Neurodegenerative Pontocerebellar Hypoplasia with Microcephaly. Neuron. 2021 Jan 20;109(2):241-256.e9
• All: 1 reference(s)