Krt13^em1Hcha
Endonuclease-mediated Allele Detail

Summary

• Symbol: Krt13^em1Hcha
• Name: keratin 13; endonuclease-mediated mutation 1, Hao Chang
• MGI ID: MGI:6509649
• Synonyms: Krt13^cr
• Gene: Krt13 Location: Chr11:100008153-100012392 bp, - strand Genetic Position: Chr11, 63.41 cM
• Alliance: Krt13^em1Hcha page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: CRISPR/Cas9 technology using sgRNA GACTTCGGAGGTGTCGATGG inserted a single nucleotide (C) in exon 1 resulting in a premature stop codon ten amino acids downstream of the inserted nucleotide. Immunostaining confirmed absence of protein expression in the tongue. (J:297664)

Disease models

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Krt13 Mutation: 38 strains or lines available

References

• Original: J:297664 Simonson L, et al., Keratin 13 deficiency causes white sponge nevus in mice. Dev Biol. 2020 Dec 1;468(1-2):146-153
• All: 1 reference(s)