Wbp11^em1Gcha
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wbp11^em1Gcha
• Name: WW domain binding protein 11; endonuclease-mediated mutation 1, Gavin Chapman
• MGI ID: MGI:6509996
• Gene: Wbp11 Location: Chr6:136790652-136805214 bp, - strand Genetic Position: Chr6, 66.72 cM
• Alliance: Wbp11^em1Gcha page

Mutation origin

• Strain of Origin: (FVB/N x C57BL/6J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using the single guide RNA AAGGCGTAGAATGCGTTCAA generated an 8 bp deletion (CCTTTGAA) in exon 5 causing a frameshift and termination of the protein 6 amino acids downstream. (J:300837)

Expression

In Mice Carrying this Mutation:	1 assay results
In Structures Affected by this Mutation:	13 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Wbp11 Mutation: 28 strains or lines available

References

• Original: J:300837 Martin EMMA, et al., Heterozygous loss of WBP11 function causes multiple congenital defects in humans and mice. Hum Mol Genet. 2021 Jan 21;29(22):3662-3678
• All: 1 reference(s)