Sprr2f^em1Jadb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sprr2f^em1Jadb
• Name: small proline-rich protein 2F; endonuclease-mediated mutation 1, James D Brooks
• MGI ID: MGI:6510021
• Synonyms: Sprr2f^-
• Gene: Sprr2f Location: Chr3:92272494-92273749 bp, + strand Genetic Position: Chr3, 40.14 cM
• Alliance: Sprr2f^em1Jadb page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 2, containing the CDS, was targeted with two sgRNAs (targeting AGACAGGCAGTCTCGAGTTC and GGGGAAGAGTACTTTCTATG) using CRISPR/Cas9 technology, resulting in a 1258 bp deletion (including the entire exon). Lack of transcript expression from this allele was confirmed by qRT-PCR. (J:299874)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Sprr2f Mutation: 14 strains or lines available

References

• Original: J:299874 Huynh KM, et al., Sprr2f protects against renal injury by decreasing the level of reactive oxygen species in female mice. Am J Physiol Renal Physiol. 2020 Nov 1;319(5):F876-F884
• All: 1 reference(s)