Borcs5^em1Jusb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Borcs5^em1Jusb
• Name: BLOC-1 related complex subunit 5; endonuclease-mediated mutation 1, Juan S Bonifacino
• MGI ID: MGI:6510587
• Synonyms: myrlysin-KO
• Gene: Borcs5 Location: Chr6:134616475-134688147 bp, + strand Genetic Position: Chr6, 65.77 cM
• Alliance: Borcs5^em1Jusb page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 2 was targeted with two sgRNAs (targeting ATCTTGGCCCGATGTTTAGC and GGCTAAACATCGGGCCAAGA) using CRISPR/Cas9 technology, resulting in a 10 bp deletion (GATGGACGAT) that leads to a frameshift and premature stop codon. (J:299228)

Expression

In Mice Carrying this Mutation:	27 assay results
In Structures Affected by this Mutation:	1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Borcs5 Mutation: 22 strains or lines available

References

• Original: J:299228 De Pace R, et al., Synaptic Vesicle Precursors and Lysosomes Are Transported by Different Mechanisms in the Axon of Mammalian Neurons. Cell Rep. 2020 Jun 16;31(11):107775
• All: 1 reference(s)