Syisl^em1Bzuo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Syisl^em1Bzuo
• Name: Synpo2 intron sense-overlapping lncRNA; endonuclease-mediated mutation 1, Bo Zuo
• MGI ID: MGI:6511001
• Gene: Syisl Location: unknown Genetic Position: Chr3, Syntenic
• Alliance: Syisl^em1Bzuo page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using sgRNAs ATGCTTTCGCCATAAGACAGTGG and CCACTATCCTATTAAAATATTAC deleted a 1133 bp region containing most of the transcript. (J:266240)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Syisl Mutation: 0 strains or lines available

References

• Original: J:266240 Jin JJ, et al., Long noncoding RNA SYISL regulates myogenesis by interacting with polycomb repressive complex 2. Proc Natl Acad Sci U S A. 2018 Oct 16;115(42):E9802-E9811
• All: 1 reference(s)