Silc1^em1Uli
Endonuclease-mediated Allele Detail

Summary

• Symbol: Silc1^em1Uli
• Name: sciatic injury induced lincRNA upregulator of SOX11; endonuclease-mediated mutation 1, Igor Ulitsky
• MGI ID: MGI:6511794
• Gene: Silc1 Location: Chr12:27190795-27210515 bp, - strand Genetic Position: Chr12, 9.86 cM
• Alliance: Silc1^em1Uli page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Hypomorph)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 mediated recombination created a deletion in exon 1. Using the forward primer TGAAGCATCCCAAGAAATCC and the reverse primer CACAGTCCTGTCCTGGTGTG the sequence remaining in the targeted region is GCACACTGCCTCTGAGATGA. Expression is reduced by more than 90% in cultured adult dorsal root ganglion cells from homozygous mice. (J:268832)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Silc1 Mutation: 3 strains or lines available

References

• Original: J:268832 Perry RB, et al., Regulation of Neuroregeneration by Long Noncoding RNAs. Mol Cell. 2018 Nov 1;72(3):553-567.e5
• All: 1 reference(s)