Ttn^em1Kage
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ttn^em1Kage
• Name: titin; endonuclease-mediated mutation 1, Katja Gehmlich
• MGI ID: MGI:6511815
• Synonyms: A178D
• Gene: Ttn Location: Chr2:76534324-76812891 bp, - strand Genetic Position: Chr2, 45.13 cM, cytoband D
• Alliance: Ttn^em1Kage page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Using CRISPR/Cas9 technology with an sgRNA (targeting AGCTCTTCCAACGCTGTTGG) and an ssODN template, a C-to-A mutation (c.533C>A) that changes alanine codon 178 to an aspartic acid codon (p.A178D) was created. This mutation mimics a mutation found in a family of autosomal dominant left ventricular non-compaction (LVNC) and familial dilated cardiomyopathy (DCM) patients. Transcript and peptide expression was not affected by this mutation, nor was localisation of the peptide. (J:302920)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ttn Mutation: 1457 strains or lines available

References

• Original: J:302920 Jiang H, et al., Functional analysis of a gene-edited mouse model to gain insights into the disease mechanisms of a titin missense variant. Basic Res Cardiol. 2021 Feb 26;116(1):14
• All: 1 reference(s)