Tmem106b^em1Damme
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem106b^em1Damme
• Name: transmembrane protein 106B; endonuclease-mediated mutation 1, Markus Damme
• MGI ID: MGI:6512073
• Synonyms: Tmem106b^del2bp
• Gene: Tmem106b Location: Chr6:13069758-13089268 bp, + strand Genetic Position: Chr6, 5.38 cM, cytoband A2
• Alliance: Tmem106b^em1Damme page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 3 (containing the start codon) was targeted with a gRNA (targeting AGTGAAGTGCACAACGAAGACGG) using CRISPR/Cas9 technology, resulting in a 2 bp deletion (AA). Immunoblots of brain and spinal cord lysates confirm the absence of peptide expression from this allele. (J:288278)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmem106b Mutation: 29 strains or lines available

References

• Original: J:288278 Luningschror P, et al., The FTLD Risk Factor TMEM106B Regulates the Transport of Lysosomes at the Axon Initial Segment of Motoneurons. Cell Rep. 2020 Mar 10;30(10):3506-3519.e6
• All: 2 reference(s)