Zmat3^em1Ast
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zmat3^em1Ast
• Name: zinc finger matrin type 3; endonuclease-mediated mutation 1, Andreas Strasser
• MGI ID: MGI:6512875
• Synonyms: Zmat3^-
• Gene: Zmat3 Location: Chr3:32388941-32419814 bp, - strand Genetic Position: Chr3, 15.67 cM, cytoband B
• Alliance: Zmat3^em1Ast page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: The genomic region containing exons 2-5 was targeted with two sgRNAs (targeting GTCAAGCATACTCCATACCC and GCGGTGTGAATTGCTGTGCC) using CRISPR/Cas9 technology, resulting in a 19773 bp deletion (deleting exons 2-5) and 2 bp insertion (CG). Western blots confirmed the absence of peptide expression from this allele. (J:271583)

Tumor Data

List all tumor models in MMHCdb carrying Zmat3^em1Ast

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Zmat3 Mutation: 56 strains or lines available

References

• Original: J:271583 Janic A, et al., DNA repair processes are critical mediators of p53-dependent tumor suppression. Nat Med. 2018 Jul;24(7):947-953
• All: 2 reference(s)