Dhdds^em1Sjpi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dhdds^em1Sjpi
• Name: dehydrodolichyl diphosphate synthase; endonuclease-mediated mutation 1, Steven J Pittler
• MGI ID: MGI:6513989
• Synonyms: Dhdds^K42E
• Gene: Dhdds Location: Chr4:133696339-133728229 bp, - strand Genetic Position: Chr4, 66.47 cM
• Alliance: Dhdds^em1Sjpi page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: A single A-to-G mutation was introduced to change codon 42 from lysine (AAG) to glutamic acid (GAG) (p.K42E), using a gRNA (targeting TCGCTATGCCAAGAAGTGTCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation mimics one associated with an autosomal recessive form of retinitis pigmentosa (RP59) in humans. (J:303192)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dhdds Mutation: 24 strains or lines available

References

• Original: J:303192 Ramachandra Rao S, et al., Lack of Overt Retinal Degeneration in a K42E Dhdds Knock-In Mouse Model of RP59. Cells. 2020 Apr 7;9(4):896
• All: 2 reference(s)