Igs7^{tm174(tetO-EGFP/RNAi:Hdac1,CAG-tdTomato,-tTA2)Tasic}
Targeted Allele Detail

Summary

• Symbol: Igs7^{tm174(tetO-EGFP/RNAi:Hdac1,CAG-tdTomato,-tTA2)Tasic}
• Name: intergenic site 7; targeted mutation 174, Bosiljka Tasic
• MGI ID: MGI:6514369
• Synonyms: Ai174, Igs7^{tm174(tetO-EGFP/RNAi:Hdac1,CAG-tdTomato,-tTA2)Hze}
• Gene: Igs7 Location: unknown Genetic Position: Chr9, Syntenic
• Alliance: Igs7^{tm174(tetO-EGFP/RNAi:Hdac1,CAG-tdTomato,-tTA2)Tasic} page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:101977
• Parent Cell Line: G4 (ES Cell)
• Strain of Origin: (129S6/SvEvTac x C57BL/6NCrl)F1

Mutation description

• Allele Type: Targeted (Conditional ready, Inducible, Reporter, Transactivator)
• Inducer: doxycycline/tetracycline
• Mutation: Insertion
• Mutation details: The vector is designed with (from 5' to 3') an FRT3 site, two copies of chicken beta-globin HS4 insulator element (to reduce reporter gene expression in absence of transactivators), a Tet response element/promoter (TRE2; details below), a loxP-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-PGKpA), an EGFP/RNAi:Hdac1 fusion protein (described below), a woodchuck hepatitis virus post-transcriptional regulatory element, a BGH polyA, two copies of chicken beta-globin HS4 insulator element, a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter, a lox2272-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-TKpA), a tdTomato sequence, a viral 2A oligopeptide), a synthetic modified tetracycline-regulated transactivator gene (tTA2(S)), a WPRE, a BGH polyA, an AttB site, a PGK-5'hygro cassette, an RNA splice donor, a FRT5 site, SA, 3'hygro, SV40pA, and AttP. The TRE2 promoter used here is Tet-responsive P>hCMV*-1<; containing the Tet response element (seven copies of the 19 bp tet operator sequence [tetO]) just upstream of a minimal cytomegalovirus promoter (P>min CMV<), which lacks the enhancer that is part of the complete CMV promoter. Consequently, P>hCMV*-1< is silent in the absence of tTA or rtTA binding to tetO. The EGFP/RNAi:HDAC1 fusion protein is composed of a synthetic enhanced green fluorescent protein sequence (EGFP), an ~150bp linker sequence and a 97bp short hairpin RNA sequence (tgctgttgacagtgagcgagcttgggtaatagcagccatttagtgaagccacagatgtaaatggctgctattacccaagcctgcctactgcctcgga) designed to target/silence the mouse histone deacetylase 1 locus (Hdac1). (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Igs7 Mutation: 70 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)