Golga4^em1Syu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Golga4^em1Syu
• Name: golgin A4; endonuclease-mediated mutation 1, Shuiqiao Yuan
• MGI ID: MGI:6514717
• Gene: Golga4 Location: Chr9:118335335-118411587 bp, + strand Genetic Position: Chr9, 70.23 cM
• Alliance: Golga4^em1Syu page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology generated a 11,771 bp deletion of exon 4 through exon 11 using two sgRNAs, sgRNA-1: TTGGTCCGGACGTCCTCCAG and sgRNA-2: TGGTAATAACCGAGACGAAG. Western blot analysis confirmed absence of protein in adult testes. (J:303296)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Golga4 Mutation: 105 strains or lines available

References

• Original: J:303296 Guo S, et al., GOLGA4, A Golgi matrix protein, is dispensable for spermatogenesis and male fertility in mice. Biochem Biophys Res Commun. 2020 Aug 27;529(3):642-646
• All: 1 reference(s)