Zc3h7ait^em1Caox
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zc3h7ait^em1Caox
• Name: zinc finger CCCH type containing 7 A intronic transcript; endonuclease-mediated mutation 1, Xuetao Cao
• MGI ID: MGI:6690238
• Synonyms: Lnczc3h7a^-
• Gene: Zc3h7ait Location: unknown Genetic Position: Chr16, Syntenic
• Alliance: Zc3h7ait^em1Caox page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: The locus was targeted with two sgRNAs (targeting GGGATGAAACTGAAGCTGTTTGG and GCTTTAATCCAGTAATCGAGAGG) using CRISPR/Cas9 technology, resulting in a 357 bp deletion. (J:282488)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Zc3h7ait Mutation: 0 strains or lines available

References

• Original: J:282488 Lin H, et al., The long noncoding RNA Lnczc3h7a promotes a TRIM25-mediated RIG-I antiviral innate immune response. Nat Immunol. 2019 Jul;20(7):812-823
• All: 1 reference(s)