Syngr3^em1Pave
Endonuclease-mediated Allele Detail

Summary

• Symbol: Syngr3^em1Pave
• Name: synaptogyrin 3; endonuclease-mediated mutation 1, Patrik Verstreken
• MGI ID: MGI:6690242
• Synonyms: synaptogyrin-3^-
• Gene: Syngr3 Location: Chr17:24904066-24908923 bp, - strand Genetic Position: Chr17, 12.47 cM, cytoband A3.3
• Alliance: Syngr3^em1Pave page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Nucleotide substitutions
• Mutation details: Exon 2 was targeted with a gRNA (targeting TTCGGACCGATTGTCAACGA) and an ssODN that introduces stop codons in all three reading frames (TAACTAGATGA), using CRISPR/Cas9 technology. Immunochemistry experiments confirmed the lack of peptide expression from this allele in the brain. (J:303506)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Syngr3 Mutation: 17 strains or lines available

References

• Original: J:303506 Largo-Barrientos P, et al., Lowering Synaptogyrin-3 expression rescues Tau-induced memory defects and synaptic loss in the presence of microglial activation. Neuron. 2021 Mar 3;109(5):767-777.e5
• All: 1 reference(s)