About   Help   FAQ
Gm16685em1Osb
Endonuclease-mediated Allele Detail
Summary
Symbol: Gm16685em1Osb
Name: predicted gene, 16685; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University
MGI ID: MGI:6690649
Synonyms: Gm16685em1Vter, mNAILdeltaNFkappaB
Gene: Gm16685  Location: Chr3:7677765-7755061 bp, + strand  Genetic Position: Chr3, 2.02 cM
Alliance: Gm16685em1Osb page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThe genomic sequence containing two conserved NFKB-binding motifs, in the promoter upstream of the locus, was targeted with crRNAs (targeting AGGGTTTAAAAGCGCATCC and AGTCTGGGAGTTTCCGATCC) and tracrRNAs using CRISPR/Cas9 technology, resulting in an 79 bp deletion. RT-qPCR experiments confirmed the lack of transcript expression from this allele and hat there was no effect on the expression of the overlapping Il7 gene on the opposite strand. (J:303079)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gm16685 Mutation:  2 strains or lines available
References
Original:  J:303079 Akincilar SC, et al., NAIL: an evolutionarily conserved lncRNA essential for licensing coordinated activation of p38 and NFkappaB in colitis. Gut. 2020 Nov 25;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory