Akr1b8^tm1Dgen
Targeted Allele Detail

Summary

• Symbol: Akr1b8^tm1Dgen
• Name: aldo-keto reductase family 1, member B8; targeted mutation 1, Deltagen
• MGI ID: MGI:6690900
• Gene: Akr1b8 Location: Chr6:34331081-34345396 bp, + strand Genetic Position: Chr6, 14.91 cM
• Alliance: Akr1b8^tm1Dgen page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:168993
• Parent Cell Line: Not Specified (ES Cell)
• Strain of Origin: Not Specified

Mutation description

• Allele Type: Targeted (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: 25 nucleotides (GCAGCAACCATGGCCACGTTCGTGG) around the ATG translational start site were replaced with a LacZ/Neo cassette. This replacement leads to a 5 amino acid deletion and downstream frame-shifting. (J:168993, J:301852)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Akr1b8 Mutation: 12 strains or lines available

References

• Original: J:168993 Derry JM, et al., Identification of genes and networks driving cardiovascular and metabolic phenotypes in a mouse F2 intercross. PLoS One. 2010;5(12):e14319
• All: 5 reference(s)