About   Help   FAQ
Akr1b8tm1Dgen
Targeted Allele Detail
Summary
Symbol: Akr1b8tm1Dgen
Name: aldo-keto reductase family 1, member B8; targeted mutation 1, Deltagen
MGI ID: MGI:6690900
Gene: Akr1b8  Location: Chr6:34331081-34345396 bp, + strand  Genetic Position: Chr6, 14.91 cM
Alliance: Akr1b8tm1Dgen page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:168993
Parent Cell Line:  Not Specified (ES Cell)
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Targeted (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation details25 nucleotides (GCAGCAACCATGGCCACGTTCGTGG) around the ATG translational start site were replaced with a LacZ/Neo cassette. This replacement leads to a 5 amino acid deletion and downstream frame-shifting. (J:168993, J:301852)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Akr1b8 Mutation:  12 strains or lines available
References
Original:  J:168993 Derry JM, et al., Identification of genes and networks driving cardiovascular and metabolic phenotypes in a mouse F2 intercross. PLoS One. 2010;5(12):e14319
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory