Del(8Ddx19a-Ddx19b)1Chaw
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Del(8Ddx19a-Ddx19b)1Chaw |
| Name: |
deletion, Chr 8, Changjiang Weng 1 |
| MGI ID: |
MGI:6693696 |
| Synonyms: |
Ddx19-Delta30919 |
| Gene: |
Del(8Ddx19a-Ddx19b)1Chaw Location: unknown Genetic Position: Chr8, Syntenic
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Intergenic deletion, Intragenic deletion
|
| |
|
Mutation details: The 3' UTR (in exon 12) of Ddx19a and exon 6 of Ddx19b were targeted using two pairs of TALENs (targeting TGGTACGGGTAAAACAGCTG, TGCAGGCTCTACTTGGCTGA, TAGCCCTGGCTTGGTGTGGT, TCTACCCTCCAAGTGCTG), resulting in the deletion of 30,919 bp of sequence including the 5' end of Ddx19a and 3' end of Ddx19b.
(J:289833)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Del(8Ddx19a-Ddx19b)1Chaw Mutation: |
0 strains or lines available
|
|
| Original: |
J:289833 Zhang K, et al., DDX19 Inhibits Type I Interferon Production by Disrupting TBK1-IKKepsilon-IRF3 Interactions and Promoting TBK1 and IKKepsilon Degradation. Cell Rep. 2019 Jan 29;26(5):1258-1272.e4 |
| All: |
1 reference(s) |
|
Analysis Tools
