Del(8Ddx19a-Ddx19b)2Chaw
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(8Ddx19a-Ddx19b)2Chaw
• Name: deletion, Chr 8, Changjiang Weng 2
• MGI ID: MGI:6693697
• Synonyms: Ddx19-Delta39002
• Gene: Del(8Ddx19a-Ddx19b)2Chaw Location: unknown Genetic Position: Chr8, Syntenic

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Intergenic deletion, Intragenic deletion
• Mutation details: The 3' UTR of Ddx19a and intron 5 of Ddx19b were targeted with two sgRNAs (targeting CTGACAACTGCCAAGAATGGTGG and GGCTCAGAGGTTAAAAGCATGGG) using CRISPR/Cas9 technology, resulting in the deletion of 39,002 bp of sequence including the entire coding region of Ddx19a and the 3' end of Ddx19b. (J:289833)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(8Ddx19a-Ddx19b)2Chaw Mutation: 0 strains or lines available

References

• Original: J:289833 Zhang K, et al., DDX19 Inhibits Type I Interferon Production by Disrupting TBK1-IKKepsilon-IRF3 Interactions and Promoting TBK1 and IKKepsilon Degradation. Cell Rep. 2019 Jan 29;26(5):1258-1272.e4
• All: 1 reference(s)