Ddx19a^em1Chaw
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ddx19a^em1Chaw
• Name: DEAD box helicase 19a; endonuclease-mediated mutation 1, Changjiang Weng
• MGI ID: MGI:6693700
• Synonyms: Ddx19a-Delta19587
• Gene: Ddx19a Location: Chr8:111701628-111724432 bp, - strand Genetic Position: Chr8, 57.86 cM, cytoband D3
• Alliance: Ddx19a^em1Chaw page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Intron 1 and the 3' UTR were targeted with two sgRNAs (targeting AGTGTAGGTCTTCCTACCTCGGG and GGCTCAGAGGTTAAAAGCATGGG) using CRISPR/Cas9 technology, resulting in the deletion of 19,587 bp. (J:289833)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ddx19a Mutation: 28 strains or lines available

References

• Original: J:289833 Zhang K, et al., DDX19 Inhibits Type I Interferon Production by Disrupting TBK1-IKKepsilon-IRF3 Interactions and Promoting TBK1 and IKKepsilon Degradation. Cell Rep. 2019 Jan 29;26(5):1258-1272.e4
• All: 1 reference(s)