Ddx19b^em1Chaw
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ddx19b^em1Chaw
• Name: DEAD box helicase 19b; endonuclease-mediated mutation 1, Changjiang Weng
• MGI ID: MGI:6693701
• Synonyms: Ddx19b-Delta4138
• Gene: Ddx19b Location: Chr8:111729820-111758383 bp, - strand Genetic Position: Chr8, 57.88 cM
• Alliance: Ddx19b^em1Chaw page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Introns 1 and 5 were targeted with two sgRNAs (targeting TGGCTGTCTAAAGGAGACTGCGG and GATTCTACCATAAGGTCCCCAGG) using CRISPR/Cas9 technology, resulting in the deletion of 4,138 bp. (J:289833)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ddx19b Mutation: 31 strains or lines available

References

• Original: J:289833 Zhang K, et al., DDX19 Inhibits Type I Interferon Production by Disrupting TBK1-IKKepsilon-IRF3 Interactions and Promoting TBK1 and IKKepsilon Degradation. Cell Rep. 2019 Jan 29;26(5):1258-1272.e4
• All: 1 reference(s)