Tmem175^em1Dren
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem175^em1Dren
• Name: transmembrane protein 175; endonuclease-mediated mutation 1, Dejian Ren
• MGI ID: MGI:6695089
• Gene: Tmem175 Location: Chr5:108777649-108795636 bp, + strand Genetic Position: Chr5, 53.24 cM
• Alliance: Tmem175^em1Dren page

Mutation origin

• Strain of Origin: (C57BL/6J x SJL/J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using sgRNAs targeting exon 3 (ttctaatcgtaactgtggcctgg) and exon 4 (tacacttgccttgctcaacctgg) deleted part of exon 3 and 4 (20 nucleotides of exon 3, 2.2 kb intron, and 47 neucleotides of exon 4), starting at the codon that encodes A88 in the second transmembrane domain, resulting in an out-of-frame truncation. (J:304120)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmem175 Mutation: 23 strains or lines available

References

• Original: J:304120 Wie J, et al., A growth-factor-activated lysosomal K(+) channel regulates Parkinson's pathology. Nature. 2021 Mar;591(7850):431-437
• All: 1 reference(s)