Ganab^em#Xche
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ganab^em#Xche
• Name: alpha glucosidase 2 alpha neutral subunit; endonuclease-mediated mutation, Xiangmei Chen
• MGI ID: MGI:6695176
• Gene: Ganab Location: Chr19:8875435-8894036 bp, + strand Genetic Position: Chr19, 5.96 cM
• Alliance: Ganab^em#Xche page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using sgRNA3 (CTGGCCCTAAAATCAAGCCTTGG) and sgRNA9 (AGGACTTCGGGAGTGGTAAATGG) located in the nonconserved region between intron 5 and intron17 generated a deletion of exons 5 to 16. The pound (#) symbol is used for the pool of several founders. (J:304107)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ganab Mutation: 45 strains or lines available

References

• Original: J:304107 Geng G, et al., Ganab Haploinsufficiency Does Not Cause Polycystic Kidney Disease or Polycystic Liver Disease in Mice. Biomed Res Int. 2020;2020:7469428
• All: 1 reference(s)