About   Help   FAQ
Vps13bem1Yosl
Endonuclease-mediated Allele Detail
Summary
Symbol: Vps13bem1Yosl
Name: vacuolar protein sorting 13B; endonuclease-mediated mutation 1, Yong-Seok Lee
MGI ID: MGI:6695987
Synonyms: Vps13b2-
Gene: Vps13b  Location: Chr15:35371306-35931375 bp, + strand  Genetic Position: Chr15, 14.46 cM, cytoband B3.3
Alliance: Vps13bem1Yosl page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 2 was targeted with two sgRNAs (targeting ACGCTTAAATTTGAAGATGCTGG and CGAGTTAAAGTTGGACGTTCTGG) using CRISPR/Cas9 technology, resulting in a 156 bp deletion that includes the start codon. Absence of exon 2 expression in the hippocampus was confirmed by RT-PCR. (J:285279)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Vps13b Mutation:  216 strains or lines available
References
Original:  J:285279 Kim MJ, et al., Spatial Learning and Motor Deficits in Vacuolar Protein Sorting-associated Protein 13b (Vps13b) Mutant Mouse. Exp Neurobiol. 2019 Aug 31;28(4):485-494
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory