Trappc9^em1Xyli
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trappc9^em1Xyli
• Name: trafficking protein particle complex 9; endonuclease-mediated mutation 1, Xueyi Li
• MGI ID: MGI:6696138
• Gene: Trappc9 Location: Chr15:72461469-72933053 bp, - strand Genetic Position: Chr15, 33.7 cM, cytoband E1
• Alliance: Trappc9^em1Xyli page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Guide RNAs (gaacgccggagtgattgagc and atgctgtgtacatcaatctc) are designed to delete 109 base pairs in exon 7. Exon 7 in humans contains a disease-causing mutation present in multiple families with intellectual disability (ID). Western blot analysis confirms the absence of protein in brain lysates. (J:304877)

Disease models

Expression

In Structures Affected by this Mutation:

8 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Trappc9 Mutation: 84 strains or lines available

References

• Original: J:304877 Ke Y, et al., Trappc9 deficiency in mice impairs learning and memory by causing imbalance of dopamine D1 and D2 neurons. Sci Adv. 2020 Nov;6(47)
• All: 2 reference(s)