Scgn^em2Ezb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scgn^em2Ezb
• Name: secretagogin, EF-hand calcium binding protein; endonuclease-mediated mutation 2, Ezra Burstein
• MGI ID: MGI:6711491
• Synonyms: Secret2
• Gene: Scgn Location: Chr13:24137439-24175197 bp, - strand Genetic Position: Chr13, 10.01 cM
• Alliance: Scgn^em2Ezb page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: The 3' end of exon 3 was targeted with an sgRNA (targeting AGGCCGCATACTGATGAAAGAGGT which includes the splice donor site) using CRISPR/Cas9 technology, resulting in a 30 bp deletion that includes exonic and intronic sequence and the exon 3 splice donor site. RT-PCR experiments show that owing to the deleted splice site, exon 3 is skipped during mRNA splicing. Immunofluorescence experiments confirm the absence of peptide expression from this allele. (J:285572)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Scgn Mutation: 20 strains or lines available

References

• Original: J:285572 Sifuentes-Dominguez LF, et al., SCGN deficiency results in colitis susceptibility. Elife. 2019 Oct 30;8:e49910
• All: 1 reference(s)