Myh7b^em1Eno
Endonuclease-mediated Allele Detail

Summary

• Symbol: Myh7b^em1Eno
• Name: myosin, heavy chain 7B, cardiac muscle, beta; endonuclease-mediated mutation 1, Eric N Olson
• MGI ID: MGI:6712699
• Synonyms: MYH7b null
• Gene: Myh7b Location: Chr2:155453132-155476227 bp, + strand Genetic Position: Chr2, 77.26 cM
• Alliance: Myh7b^em1Eno page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: Exon 2 was targeted with an sgRNA (targeting TGATGGATATGAGTGAACTTGG) and an ssODN containing three poly(A) signals flanked by homology arms using CRISPR/Cas9 technology. In the resulting allele transcription is disrupted by the insertion of premature poly(A) signals in exon 2. (J:285433)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Myh7b Mutation: 81 strains or lines available

References

• Original: J:285433 Peter AK, et al., Expression of Normally Repressed Myosin Heavy Chain 7b in the Mammalian Heart Induces Dilated Cardiomyopathy. J Am Heart Assoc. 2019 Aug 6;8(15):e013318
• All: 1 reference(s)