Zfp750^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp750^em1(IMPC)J
• Name: zinc finger protein 750; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6712815
• Gene: Zfp750 Location: Chr11:121401804-121410159 bp, - strand Genetic Position: Chr11, 85.49 cM
• Alliance: Zfp750^em1(IMPC)J page
• IMPC: Zfp750 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TCAGTGCTATGGCTAGAGAG and GACTCATTATCCTTTGTGTT, which resulted in a 2279 bp deletion beginning at Chromosome 11 position 121,402,605 bp and ending after 121,404,883 bp (GRCm39). This mutation deletes 1431 bp of ENSMUSE00000307208 exon 2, 127 bp of intron 2-3 and 721 bp of ENSMUSE00000367226 exon 3 including the splice acceptor, start site splice donor and termination codon. This allele is predicted to be a null. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfp750 Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)