Snord115^em1Jcav
Endonuclease-mediated Allele Detail

Summary

• Symbol: Snord115^em1Jcav
• Name: small nucleolar RNA, C/D Box 115 cluster; endonuclease-mediated mutation 1, Jerome Cavaille
• MGI ID: MGI:6714008
• Gene: Snord115 Location: unknown Genetic Position: Chr7, Syntenic

Mutation origin

• Strain of Origin: (C57BL/6J x CBA)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intergenic deletion
• Mutation details: CRISPR/Cas9 technology using sgRNAs CCTTAGTATGTGATATACCTCAA and CCCGTACTCTTGTTCTAGGATGC deleted the entire gene complex. PCR and Northern blot analysis confirmed the absence of expression upon paternally inherited deletion, while expression remains unaffected upon maternal transmission of the allele. (J:305741)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Snord115 Mutation: 0 strains or lines available

References

• Original: J:305741 Hebras J, et al., Reassessment of the involvement of Snord115 in the serotonin 2c receptor pathway in a genetically relevant mouse model. Elife. 2020 Oct 5;9:e60862
• All: 1 reference(s)