About   Help   FAQ
Ccr1l1em2Semp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccr1l1em2Semp
Name: C-C motif chemokine receptor 1 like 1; endonuclease-mediated mutation 2, Sergio M Pontejo
MGI ID: MGI:6714048
Synonyms: Ccr1l1-
Gene: Ccr1l1  Location: Chr9:123777280-123778445 bp, - strand  Genetic Position: Chr9, 75.05 cM, cytoband F
Alliance: Ccr1l1em2Semp page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsUpstream of the locus and exon 1 were targeted with two sgRNAs (targeting GCTTTGCTATTAAACACGTAGGG and GGTATCTATCAATCGTAAGCAGG) using CRISPR/Cas9 technology, resulting in a 489 bp deletion that includes the start codon. (J:304824)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ccr1l1 Mutation:  11 strains or lines available
References
Original:  J:304824 Kline JM, et al., Structural and functional analysis of Ccr1l1, a Rodentia-restricted eosinophil-selective chemokine receptor homologue. J Biol Chem. 2021 Feb 3;:100373
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory