Ccr1l1em2Semp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ccr1l1em2Semp |
| Name: |
C-C motif chemokine receptor 1 like 1; endonuclease-mediated mutation 2, Sergio M Pontejo |
| MGI ID: |
MGI:6714048 |
| Synonyms: |
Ccr1l1- |
| Gene: |
Ccr1l1 Location: Chr9:123777280-123778445 bp, - strand Genetic Position: Chr9, 75.05 cM, cytoband F
|
| Alliance: |
Ccr1l1em2Semp page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: Upstream of the locus and exon 1 were targeted with two sgRNAs (targeting GCTTTGCTATTAAACACGTAGGG and GGTATCTATCAATCGTAAGCAGG) using CRISPR/Cas9 technology, resulting in a 489 bp deletion that includes the start codon.
(J:304824)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Ccr1l1 Mutation: |
11 strains or lines available
|
|
| Original: |
J:304824 Kline JM, et al., Structural and functional analysis of Ccr1l1, a Rodentia-restricted eosinophil-selective chemokine receptor homologue. J Biol Chem. 2021 Feb 3;:100373 |
| All: |
1 reference(s) |
|
Analysis Tools
