Sros1^em1Caox
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sros1^em1Caox
• Name: non-coding RNA suppressor of Stat1; endonuclease-mediated mutation 1, Xuetao Cao
• MGI ID: MGI:6715665
• Synonyms: Sros1^-
• Gene: Sros1 Location: Chr10:122400928-122405796 bp, - strand Genetic Position: Chr10, Syntenic
• Alliance: Sros1^em1Caox page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using sgRNAs GAATGATTATTATTGATAGATGG and GTTATTCTCCATGTCGTATGTGG deleted exons 1-3. (J:306407)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Sros1 Mutation: 0 strains or lines available

References

• Original: J:306407 Xu H, et al., Inducible degradation of lncRNA Sros1 promotes IFN-gamma-mediated activation of innate immune responses by stabilizing Stat1 mRNA. Nat Immunol. 2019 Dec;20(12):1621-1630
• All: 1 reference(s)