Ip6k1^em1Seyk
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ip6k1^em1Seyk
• Name: inositol hexaphosphate kinase 1; endonuclease-mediated mutation 1, Seyun Kim
• MGI ID: MGI:6718594
• Synonyms: IP6K1-KO
• Gene: Ip6k1 Location: Chr9:107879847-107925981 bp, + strand Genetic Position: Chr9, 59.07 cM, cytoband F2
• Alliance: Ip6k1^em1Seyk page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 2, containing the ATG start codon, was targeted with two sgRNAs (targeting TTTGTCAAACCATGGAAGTGGGG and CCGCCCACCTGATGGATGAAGGG) using CRISPR/Cas9 technology, resulting in a 73 bp deletion. Absence of peptide expression from this allele was confirmed by immunoblot experiments with brain extracts. (J:306957)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ip6k1 Mutation: 71 strains or lines available

References

• Original: J:306957 Park SJ, et al., Inositol Pyrophosphate Metabolism Regulates Presynaptic Vesicle Cycling at Central Synapses. iScience. 2020 Apr 24;23(4):101000
• All: 1 reference(s)