Adsl^em1Svap
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adsl^em1Svap
• Name: adenylosuccinate lyase; endonuclease-mediated mutation 1, Svante Paabo
• MGI ID: MGI:6720350
• Gene: Adsl Location: Chr15:80832691-80855147 bp, + strand Genetic Position: Chr15, 37.95 cM
• Alliance: Adsl^em1Svap page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Codons Arg428Ala429 (CGGGCA) were changed to GlnVal (CAGGTT) (p.428_429delinsQV) using two sgRNAs (targeting GGCTGAAGTAGGCATCTGCC and CTCACAGCTGGAGCACTTGC) and an ssODN (GTGGTCAAGCAGGAAGGAGGTGACAATGACCTTATAGAGCGCATCCAGGTTGACGCCTACTTCAGCCCCATCCACTCACAGCTGGAGCACTTGCTGGAC) with CRISPR/Cas9 technology. This mutation in the active domain mimics the sequence in the human ortholog, thought to be associated with the lower stability/activity of the enzyme in modern humans compared to other tetrapods, other primates and human ancestors. (J:307180)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Adsl Mutation: 37 strains or lines available

References

• Original: J:307180 Stepanova V, et al., Reduced purine biosynthesis in humans after their divergence from Neandertals. Elife. 2021 May 4;10:e58741
• All: 1 reference(s)