Dnah9^em1Hmd
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnah9^em1Hmd
• Name: dynein, axonemal, heavy chain 9; endonuclease-mediated mutation 1, Hiroshi Hamada
• MGI ID: MGI:6720876
• Synonyms: Dnah9^-
• Gene: Dnah9 Location: Chr11:65722150-66059379 bp, - strand Genetic Position: Chr11, 40.53 cM
• Alliance: Dnah9^em1Hmd page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 30 was targeted with two sgRNAs (targeting TCAGACATAGAAGTGCGAGATGG and GATCGATCTTACAGCTTGTCTGG) using CRISPR/Cas9 technology, resulting in the deletion of the exon. (J:301033)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dnah9 Mutation: 233 strains or lines available

References

• Original: J:301033 Ide T, et al., CFAP53 regulates mammalian cilia-type motility patterns through differential localization and recruitment of axonemal dynein components. PLoS Genet. 2020 Dec;16(12):e1009232
• All: 1 reference(s)