Fsip2^em1Nali
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fsip2^em1Nali
• Name: fibrous sheath-interacting protein 2; endonuclease-mediated mutation 1, Na Li
• MGI ID: MGI:6724283
• Synonyms: Fsip2-KI
• Gene: Fsip2 Location: Chr2:82773978-82839281 bp, + strand Genetic Position: Chr2, 49.08 cM
• Alliance: Fsip2^em1Nali page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Null/knockout)
• Mutation: Insertion
• Mutation details: A C was inserted into exon 16 (c.8137insC) using an sgRNA (targeting ATCAAGAACAAGTTATCTGCTGG) and an ssODN (AGCAGTACTAAGACCAAAATCAAGAACAAGTTAagcGCTGGAGAGAAAAcCTCCAAGAGAGAGCAGACCAAAACCGCCCTTGGGCTGCCACAAACTCCAC) with CRISPR/Cas9 technology. This mutation mimics a mutation found in multiple morphological abnormalities of the sperm flagella (MMAF) patients. Reduced transcript expression was confirmed by RT-qPCR and absence of peptide expression by immunostaining. (J:307606)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Fsip2 Mutation: 333 strains or lines available

References

• Original: J:307606 Fang X, et al., Hypomorphic and hypermorphic mouse models of Fsip2 indicate its dosage-dependent roles in sperm tail and acrosome formation. Development. 2021 Jun 1;148(11):dev199216
• All: 1 reference(s)