Ddi1^em1Qsh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ddi1^em1Qsh
• Name: DNA-damage inducible 1; endonuclease-mediated mutation 1, Qinghua Shi
• MGI ID: MGI:6724340
• Synonyms: Ddi1^-
• Gene: Ddi1 Location: Chr9:6265028-6266547 bp, - strand Genetic Position: Chr9, 2.46 cM, cytoband A1
• Alliance: Ddi1^em1Qsh page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: The single-exon gene was targeted with an sgRNA (targeting GCTGTTCCATGTAAACGATC) using CRISPR/Cas9 technology, resulting in a 26 bp deletion (c.120-145del, p.P41Hfs*8). Western blot and immunohistochemistry experiments confirmed the absence of peptide expression in testes. (J:307592)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ddi1 Mutation: 20 strains or lines available

References

• Original: J:307592 Yousaf A, et al., Normal spermatogenesis and fertility in Ddi1 (DNA damage inducible 1) mutant mice. Reprod Biol. 2020 Dec;20(4):520-524
• All: 1 reference(s)