Phyhipl^em1Tsdk
Endonuclease-mediated Allele Detail

Summary

• Symbol: Phyhipl^em1Tsdk
• Name: phytanoyl-CoA hydroxylase interacting protein-like; endonuclease-mediated mutation 1, Tetsushi Sadakata
• MGI ID: MGI:6726306
• Synonyms: PHY2^S19X
• Gene: Phyhipl Location: Chr10:70393516-70435121 bp, - strand Genetic Position: Chr10, 36.69 cM
• Alliance: Phyhipl^em1Tsdk page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/Cas9 mediated recombination using the target sequence CATATCCCATGAGATCTTGAAGG introduced a CC to AG mutation resulting in a Ser19Stop substitution. Western blot analysis demonstrated the absence of protein in the cerebellum of homozygous mutant mice. (J:307852)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Phyhipl Mutation: 28 strains or lines available

References

• Original: J:307852 Sugimoto H, et al., The Ser19Stop single nucleotide polymorphism (SNP) of human PHYHIPL affects the cerebellum in mice. Mol Brain. 2021 Mar 12;14(1):52
• All: 1 reference(s)