Tsga8^em2Ohbo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tsga8^em2Ohbo
• Name: testis specific gene A8; endonuclease-mediated mutation 2, Kazuyuki Ohbo
• MGI ID: MGI:6726554
• Synonyms: Tsga8^-#2
• Gene: Tsga8 Location: ChrX:82530284-82531530 bp, - strand Genetic Position: ChrX, 38.38 cM
• Alliance: Tsga8^em2Ohbo page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 2 was targeted with an sgRNA (targeting CCACGCTTGTTGGTCTTCGCACC) using CRISPR/Cas9 technology, resulting in a 14 bp deletion (TTGTTGGTCTTCGC). Immunohistochemistry and Western blot experiments confirm the absence of peptide expression from this allele in testes. (J:307409)

Disease models

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tsga8 Mutation: 2 strains or lines available

References

• Original: J:307409 Kobayashi Y, et al., Tsga8 is required for spermatid morphogenesis and male fertility in mice. Development. 2021 Apr 15;148(8):dev196212
• All: 1 reference(s)