Cfap47^em1Fzh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cfap47^em1Fzh
• Name: cilia and flagella associated protein 47; endonuclease-mediated mutation 1, Feng Zhang
• MGI ID: MGI:6727102
• Synonyms: Cfap47^-
• Gene: Cfap47 Location: ChrX:78310165-78560891 bp, - strand Genetic Position: ChrX, 38.37 cM
• Alliance: Cfap47^em1Fzh page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: Exon 15 was targeted with an sgRNA (targeting CCTGTTTTCGTGGTACAGTTAGG) using CRISPR/Cas9 technology, resulting in the insertion or duplication of a T in the coding sequence (c.2559insT) that causes a frameshift and premature stop codon. RT-qPCR showed reduced transcript expression from this allele in testes and immunohistochemistry experiments showed absence of protein expression. (J:307391)

Disease models

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cfap47 Mutation: 6 strains or lines available

References

• Original: J:307391 Liu C, et al., Deleterious variants in X-linked CFAP47 induce asthenoteratozoospermia and primary male infertility. Am J Hum Genet. 2021 Feb 4;108(2):309-323
• All: 1 reference(s)