Trpm3em1Alsh
Endonuclease-mediated Allele Detail
|
Symbol: |
Trpm3em1Alsh |
Name: |
transient receptor potential cation channel, subfamily M, member 3; endonuclease-mediated mutation 1, Alan Shiels |
MGI ID: |
MGI:6727113 |
Synonyms: |
Trpm3M, Trpm3-mutant |
Gene: |
Trpm3 Location: Chr19:22116410-22972774 bp, + strand Genetic Position: Chr19, 16.05 cM
|
Alliance: |
Trpm3em1Alsh page
|
|
Strain of Origin: |
C57BL/6J x CBA
|
|
Allele Type: |
|
Endonuclease-mediated (Dominant negative) |
Mutation: |
|
Single point mutation
|
|
|
Mutation details: Isoleucine codon 65 in exon 4 was targeted with sgRNAs (targeting TGTTTCAGGCTCAGAAATCCNGG and ATAAAATGCTCTTTCAATCCNGG ) and an ssODN (ATGGGGGTCTTTGGTGCTCGGTATGATGTGAACACATTCTCTTTTATAAAATGCTCTTTCCATCCAAGACTTCTGAGCCTGAAACAAAACGAGAGAGAGAGAAAAAAAGATGAATATAAATTTTAAATCT ) using CRISPR/Cas9 technology, resulting in a T-to-G mutation (c.195T>G) that changes it to a methionine codon (p.I65M). This mutation mimics a mutation associated with early-onset or pediatric cataract in humans.
(J:307352)
|
Inheritance: |
|
Semidominant |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Trpm3 Mutation: |
101 strains or lines available
|
|
Original: |
J:307352 Zhou Y, et al., Mutation of the TRPM3 cation channel underlies progressive cataract development and lens calcification associated with pro-fibrotic and immune cell responses. FASEB J. 2021 Feb;35(2):e21288 |
All: |
2 reference(s) |
|