About   Help   FAQ
Pcdhga7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pcdhga7em1(IMPC)J
Name: protocadherin gamma subfamily A, 7; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6727352
Gene: Pcdhga7  Location: Chr18:37847887-37974926 bp, + strand  Genetic Position: Chr18, 19.58 cM
Alliance: Pcdhga7em1(IMPC)J page
IMPC: Pcdhga7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAATGGCGCCTGGACAGAG and GGGTGAAGCCCCAAGTTCCC, which resulted in a 2435 bp deletion beginning at Chromosome 18 position 37,847,990 bp and ending after 37,850,424 bp (GRCm39/mm39). This mutation deletes 2435 bp from ENSMUSE00001346069 (exon 1) including the start site but leaves the last 3 nucleotides before the end of the exon, and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pcdhga7 Mutation:  86 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory