Magi3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Magi3^em1(IMPC)J
• Name: membrane associated guanylate kinase, WW and PDZ domain containing 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6727368
• Gene: Magi3 Location: Chr3:103920575-104127690 bp, - strand Genetic Position: Chr3, 45.52 cM
• Alliance: Magi3^em1(IMPC)J page
• IMPC: Magi3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGGGTGTGAGAAAAACAC and TTTAGGAATGGAGCACAAAA, which resulted in a 7616 bp deletion beginning at Chromosome 3 position 103,956,433 bp and ending after 103,964,048 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000421484, ENSMUSE00000421384, ENSMUSE00000421452, and ENSMUSE00000421379 (exons 8-11) and 6694 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 361 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Magi3 Mutation: 87 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)