Atxn7l1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atxn7l1^em1(IMPC)J
• Name: ataxin 7-like 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6727371
• Gene: Atxn7l1 Location: Chr12:33197692-33423184 bp, + strand Genetic Position: Chr12, 14.03 cM, cytoband B2
• Alliance: Atxn7l1^em1(IMPC)J page
• IMPC: Atxn7l1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGTGATAACGATAAGCGG and TCTGGAGTGTAGCTGCAAGT, which resulted in a 478 bp deletion beginning at Chromosome 12 position 33,391,845 bp and ending after 33,392,322 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000655323 (exon 3) and 203 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 68. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Atxn7l1 Mutation: 36 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)