Zfp622^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp622^em1(IMPC)J
• Name: zinc finger protein 622; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6731067
• Synonyms: Zfp622^-
• Gene: Zfp622 Location: Chr15:25984452-25998567 bp, + strand Genetic Position: Chr15, 9.71 cM
• Alliance: Zfp622^em1(IMPC)J page
• IMPC: Zfp622 gene page

Zfp622^em1(IMPC)J/Zfp622^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as dying morulae. Mutants fail to hatch from the zona pellucida and never reach blastocyst stage in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCATTCCCTGGAATCATT and TCCGTCTGACTCCTTTCCAG, which resulted in a 5037 bp deletion beginning at Chromosome 15 position 25,991,444 bp and ending after 25,996,480 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000562948, ENSMUSE00000562947 (exons 4 and 5) and 4780 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 351 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp622 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)