Ppp2r2d^em1Gct
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ppp2r2d^em1Gct
• Name: protein phosphatase 2, regulatory subunit B, delta; endonuclease-mediated mutation 1, George C Tsokos
• MGI ID: MGI:6731086
• Synonyms: R2D^fl
• Gene: Ppp2r2d Location: Chr7:138448073-138484786 bp, + strand Genetic Position: Chr7, 82.95 cM
• Alliance: Ppp2r2d^em1Gct page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: LoxP sites were inserted into introns 5 and 6 using sgRNAs (targeting CCACACCGAGCAACTGATAACCC and CCACTTCTAGCCCTCCCGGTGAAC) and ssODNs with CRISPR/Cas9 technology. (J:308373)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ppp2r2d Mutation: 311 strains or lines available

References

• Original: J:308373 Pan W, et al., PPP2R2D suppresses IL-2 production and Treg function. JCI Insight. 2020 Oct 2;5(19)
• All: 2 reference(s)