4930524B15Rik^em1Qsh
Endonuclease-mediated Allele Detail

Summary

• Symbol: 4930524B15Rik^em1Qsh
• Name: RIKEN cDNA 4930524B15 gene; endonuclease-mediated mutation 1, Qinghua Shi
• MGI ID: MGI:6739918
• Synonyms: 4930524B15Rik^-
• Gene: 4930524B15Rik Location: Chr11:31915592-31929651 bp, + strand Genetic Position: Chr11, 18.71 cM, cytoband A4
• Alliance: 4930524B15Rik^em1Qsh page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Duplication, Insertion
• Mutation details: Exon 1 of the gene was targeted with sgRNAs (targeting CTCCGAGGTTTCGGCCATCGG and CTGGAAAGGGGCGGAATCCGG) using CRISPR/Cas9 technology, resulting in a one nucleotide insertion (duplication) (A) before/after (of) coding nucleotide 116, causing a frameshift and premature stop codon. (J:308296)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any 4930524B15Rik Mutation: 2 strains or lines available

References

• Original: J:308296 Khan R, et al., Evolutionarily conserved and testis-specific gene, 4930524B15Rik, is not essential for mouse spermatogenesis and fertility. Mol Biol Rep. 2020 Jul;47(7):5207-5213
• All: 1 reference(s)