Arl14^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arl14^em1(IMPC)J
• Name: ADP-ribosylation factor-like 14; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6740188
• Gene: Arl14 Location: Chr3:69129752-69130951 bp, + strand Genetic Position: Chr3, 32.2 cM, cytoband E3
• Alliance: Arl14^em1(IMPC)J page
• IMPC: Arl14 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGTCCGAGGAGAAGAATGT and TTTCTGCTTGAAGATTGCTA, which resulted in a 524 bp deletion beginning at Chromosome 3 position 69,129,897 bp and ending after 69,130,420 bp (GRCm39/mm39). This mutation deletes 524 bp from ENSMUSE00001258649 (exon 1) and is predicted to cause a change of amino acid sequence after residue 14 and termination 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Arl14 Mutation: 7 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)