About   Help   FAQ
4933411K16Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: 4933411K16Rikem1(IMPC)J
Name: RIKEN cDNA 4933411K16 gene; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6740198
Gene: 4933411K16Rik  Location: Chr19:42040687-42042066 bp, + strand  Genetic Position: Chr19, 35.68 cM, cytoband D1
Alliance: 4933411K16Rikem1(IMPC)J page
IMPC: 4933411K16Rik gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGTCTTCTGTAGTCTCAG and AGCCATAGATTGGGTTTCTG, which resulted in an 863 bp deletion beginning at Chromosome 19 position 42,040,905 bp and ending after 42,041,767 bp (GRCm39/mm39). This mutation deletes 863 bp of ENSMUSE00000897965 (exon 1) is predicted to cause a change of amino acid sequence after residue 12 and termination 19 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any 4933411K16Rik Mutation:  17 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory