Rassf10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rassf10^em1(IMPC)J
• Name: Ras association (RalGDS/AF-6) domain family (N-terminal) member 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6740202
• Gene: Rassf10 Location: Chr7:112553169-112556664 bp, + strand Genetic Position: Chr7, 59.13 cM
• Alliance: Rassf10^em1(IMPC)J page
• IMPC: Rassf10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTCTTCTCCGAAGGATCCA and TACACAAGGGATTCACACAC, which resulted in a 1510 bp deletion beginning at Chromosome 7 position 112,553,404 bp and ending after 112,554,913 bp (GRCm39/mm39). This mutation deletes 1510 ENSMUSE00001243839 (exon 1) and is predicted to cause a change of amino acid sequence after residue 1 and termination 11 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rassf10 Mutation: 12 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)