About   Help   FAQ
Rassf10em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rassf10em1(IMPC)J
Name: Ras association (RalGDS/AF-6) domain family (N-terminal) member 10; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6740202
Gene: Rassf10  Location: Chr7:112553169-112556664 bp, + strand  Genetic Position: Chr7, 59.13 cM
Alliance: Rassf10em1(IMPC)J page
IMPC: Rassf10 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTCTTCTCCGAAGGATCCA and TACACAAGGGATTCACACAC, which resulted in a 1510 bp deletion beginning at Chromosome 7 position 112,553,404 bp and ending after 112,554,913 bp (GRCm39/mm39). This mutation deletes 1510 ENSMUSE00001243839 (exon 1) and is predicted to cause a change of amino acid sequence after residue 1 and termination 11 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rassf10 Mutation:  12 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory