Tmem212^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem212^em1(IMPC)J
• Name: transmembrane protein 212; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6740211
• Gene: Tmem212 Location: Chr3:27920215-27950517 bp, - strand Genetic Position: Chr3, 11.05 cM
• Alliance: Tmem212^em1(IMPC)J page
• IMPC: Tmem212 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTATGTAGAGGGCACAAC and TCGTGACCTAACAGGAGCGG, which resulted in a 2249 bp deletion plus a 1 base pair insertion (T) beginning at Chromosome 3 position 27,938,683 bp and ending after 27,940,931 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000364670, ENSMUSE00000409111 (exons 2 and 3) and 1866 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmem212 Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)